90
|
Metabion International AG
primers m13rev Primers M13rev, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13-rev+primer/pm11136717-118-9-28?v=Metabion+International+AG Average 90 stars, based on 1 article reviews
primers m13rev - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
ACGT Inc
m13rev t7 primers M13rev T7 Primers, supplied by ACGT Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13-rev+primer/pmc00090802-100-16-21?v=ACGT+Inc Average 90 stars, based on 1 article reviews
m13rev t7 primers - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Promega
primers agcggccgctaaatataaatccgttaaaataat and m13 rev Primers Agcggccgctaaatataaatccgttaaaataat And M13 Rev, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13-rev+primer/10__1128_slash_jvi__75__10__4802___4813__2001-44-10-12?v=Promega Average 90 stars, based on 1 article reviews
primers agcggccgctaaatataaatccgttaaaataat and m13 rev - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
86
|
Eurofins
m13rev 29 primer M13rev 29 Primer, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13-rev+primer/pmc12780176-428-12-22?v=Eurofins Average 86 stars, based on 1 article reviews
m13rev 29 primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |
90
|
AgriGenome Labs
universal primer pair Universal Primer Pair, supplied by AgriGenome Labs, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13-rev+primer/10__1007_slash_s10658___022___02541___7-56-7-12?v=AgriGenome+Labs Average 90 stars, based on 1 article reviews
universal primer pair - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
90
|
Sequiserve GmbH
m13rev primer M13rev Primer, supplied by Sequiserve GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13-rev+primer/pm21628446-58-9-11?v=Sequiserve+GmbH Average 90 stars, based on 1 article reviews
m13rev primer - by Bioz Stars,
2026-08
90/100 stars
|
Buy from Supplier |
86
|
Biofab Inc
m13 rev primer M13 Rev Primer, supplied by Biofab Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/m13-rev+primer/pm42070587-68-18-21?v=Biofab+Inc Average 86 stars, based on 1 article reviews
m13 rev primer - by Bioz Stars,
2026-08
86/100 stars
|
Buy from Supplier |